Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: UMB709

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	UMB709
Reference	Beaubien KA and Smith KP (2006) New SSR markers for barley derived from the EST database Barley Genetics Newsletter 30:30-43.
General Remarks	See reference for PCR and amplification conditions
Type	SSR
PCR primers	ACGACAAGACTATGGCAGCA AAGGTTTCCTCAGCCTGTGA
Sequence	CV063649