Query (optional)   in Class  

GrainGenes Probe Report: WBE111

[What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
WBE111  [ Marker Report ]
Locus
WBE111
Reference
ReferenceMarcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500.
PCR primers
5' ggggctcatccgcatcttctt 3'
5' tcagcaatcacggcaactaaacaa 3'
Amplification Conditions
5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 60 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Source Species
Hordeum vulgare