Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: WCS66

[What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	WCS66
Synonym	Other name L27516
Reference	Chauvin LP et al. (1994) Nucleotide sequence of a new member of the freezing tolerance associated protein family in wheat Plant Physiology 105:1017-1018. Houde M et al. (1992) A molecular marker to select for freezing tolerance in Gramineae Molecular and General Genetics 234:43-48. Houde M et al. (1992) Cloning, characterization, and expression of a cDNA encoding a 50 Kilodalton protein specifically induced by cold acclimation in wheat Plant Physiology 99:1381-1387.
General Remarks	Primers selected from wheat Wcs66 gene.
Type	PCR STS
PCR primers	R:TGCCGGTCACTCCAGCGTGT L:GGCCACGGTGACCACAAGGA
Amplification Conditions	Anneal at 50oC.
Sequence	L27516
Linkage Group	Fragment amplified by primers mapped to 4A.
Source Species	Triticum aestivum
Source Germplasm	NORSTAR
PCR size	0.603