Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: WG541

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	WG541  [ Marker Report ]
Locus	WG541 Xcnl.WG541 HD030K11 Xwg541
Synonym	Synonym HAR35_20759 HAR35_26572 HAR35_4256
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	TCCAACCAAAGGAACGAAGG AATTCGATCGCACCGTCGGA
Sequence	WG541 WG541-5 WG541-3
Linkage Group	[b 7LS]
Insert Enzyme	PstI
Source Species	Triticum aestivum
Insert Size	1.4