Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: X2AS33

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	X2AS33
Locus	X2AS33
Reference	Hou LY et al. (2016) Molecular Mapping of the Stripe Rust Resistance Gene Yr69 on Wheat Chromosome 2AS Plant Disease 100:1717-1724.
Type	EST-SSR
PCR primers	Forward: atttgtttacgccgagca Reverse: atccagcattacattacatca