GrainGenes Probe Report: WAPO-A1
Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.
Probe
WAPO-A1
URL
WAPO1. A candidate gene for spikelet number per spike protocol at MASWheat
Reference
General Remarks
PCR conditions to detect the 115-bp deletion: Denaturing step: 5 min at 94 degrees C; 35 cycles of: [94 degrees C 30s, 60 degrees C 30s, 72 degrees C 30s]; Extension step: 7 min at 72 degrees C Expected products: Separate in a 2% agarose gel: WAPO-A1a: one band of approx. 100-bp; WAPO-A1b, WAPO-A1c, WAPO-A1d : one band of approx. 200-bp dCAPS PCR conditions to detech the C47F polymorphism: Denaturing step: 5 min at 94 degrees C; 35 cycles of: [94 degrees C 30s, 65 degrees C 30s, 72 degrees C 30s]; Extension step: 7 min at 72 degrees C dCAPS digestion: Enzyme: HpyCH4V; Conditions: digest in Cutsmart Buffer for 2 h at 37 degrees C, dCAPS Expected products: Separate in a 2% agarose gel: WAPO-A1b: one band of 200-bp; WAPO-A1a, WAPO-A1c, WAPO-A1d: one band of 180-bp
Type
PCR
PCR primers
WAPO1_pro_F 5'- ACGGTTCCTCTTCCTGCTCAT -3' WAPO1_pro_R 5'- CGGAGGCGAGGACGAGT -3' WAPO1_C47F_F 5'- agctcactcactctcActccA -3' WAPO1_C47F_R 5'- GAAGGTCGGAGTCAACGGATTgaggaaggacggcgtcgggatg -3'
Source Gene
WAPO1 (Triticum)
Source Allele
WAPO-A1a (Triticum) WAPO-A1b (Triticum) WAPO-A1c (Triticum) WAPO-A1d (Triticum)
Source Species
Triticum aestivum
GrainGenes Probe Report: WAPO-A1
Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.
|
| ||||||
|
| ||||||
| |||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
|
