Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: WAPO-A1

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	WAPO-A1
URL	WAPO1. A candidate gene for spikelet number per spike protocol at MASWheat
Reference	Kuzay S et al. (2019) Identification of a candidate gene for a QTL for spikelet number per spike on wheat chromosome arm 7AL by high-resolution genetic mapping Theoretical and Applied Genetics 132:2689-2705.
General Remarks	PCR conditions to detect the 115-bp deletion: Denaturing step: 5 min at 94 degrees C; 35 cycles of: [94 degrees C 30s, 60 degrees C 30s, 72 degrees C 30s]; Extension step: 7 min at 72 degrees C Expected products: Separate in a 2% agarose gel: WAPO-A1a: one band of approx. 100-bp; WAPO-A1b, WAPO-A1c, WAPO-A1d : one band of approx. 200-bp dCAPS PCR conditions to detech the C47F polymorphism: Denaturing step: 5 min at 94 degrees C; 35 cycles of: [94 degrees C 30s, 65 degrees C 30s, 72 degrees C 30s]; Extension step: 7 min at 72 degrees C dCAPS digestion: Enzyme: HpyCH4V; Conditions: digest in Cutsmart Buffer for 2 h at 37 degrees C, dCAPS Expected products: Separate in a 2% agarose gel: WAPO-A1b: one band of 200-bp; WAPO-A1a, WAPO-A1c, WAPO-A1d: one band of 180-bp
Type	PCR
PCR primers	WAPO1_pro_F 5'- ACGGTTCCTCTTCCTGCTCAT -3' WAPO1_pro_R 5'- CGGAGGCGAGGACGAGT -3' WAPO1_C47F_F 5'- agctcactcactctcActccA -3' WAPO1_C47F_R 5'- GAAGGTCGGAGTCAACGGATTgaggaaggacggcgtcgggatg -3'
Source Gene	WAPO1 (Triticum)
Source Allele	WAPO-A1a (Triticum) WAPO-A1b (Triticum) WAPO-A1c (Triticum) WAPO-A1d (Triticum)
Source Species	Triticum aestivum