Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: Sr46

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	Sr46
Locus	Sr46
Reference	Athiyannan N et al. (2022) Haplotype variants of Sr46 in Aegilops tauschii, the diploid D genome progenitor of wheat Theoretical and Applied Genetics 135:2627-2639.
General Remarks	Diagnostic marker with short amplicon to perform rapid PCR detection Amplification conditions: PCR was performed with initial denaturation at 94 deg. C for 3min, followed by 32 cycles starting at 94 deg. C for 40s and then 58 deg. C for 1min followed by 72 deg. C for 40s. Amplification was completed with a 2min extension at 72 deg. C.
Type	STS
PCR primers	GTTGGGAAGTGATGATGTGGAACGG CCTCAACTCCTCCGGACAGTGATGA
Sequence	Sr46_Diagnostic
Source Species	Aegilops tauschii
Source Germplasm	Aegilops tauschii CPI110672