Query (optional)   in Class  

GrainGenes Probe Report: sts32

[What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
sts32
Reference
ReferenceSchweiger W et al. (2016) Suppressed recombination and unique candidate genes in the divergent haplotype encoding Fhb1, a major Fusarium head blight resistance locus in wheat Theoretical and Applied Genetics 129:1607-1623.
ReferenceLiu S et al. Toward positional cloning of Fhb1 , a major QTL for Fusarium head blight resistance in wheat Cereal Research Communications 36:195-201.
General Remarks
(Curator Note, VCB 2023) The probe STS32 also exists and was mapped on 3B. These may be the same.
Primers used to screen a BAC library for Fhb1. See reference for links to additional markers.
common PCR protocol: 15'' denaturing 94deg. C/15'' annealing/15'' elongation, 45 cycles, 375 nM primer, 40ng/ul DNA, ssoAdvanced polymerase, 5ul reaction volume
Type
PCR
PCR primers
GGACGAGTCCTCAGCCCTAT
CGGTGAAGATGAGCTTCCAT