Query (optional)   in Class  

GrainGenes Probe Report: Xstars-KASP335

[What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
Xstars-KASP335
Reference
ReferenceXu X et al. (2022) Identification and characterization of the novel leaf rust resistance gene Lr81 in wheat Theoretical and Applied Genetics 135:2725-2734.
General Remarks
SNP position in Chinese Spring IWGSC v1.0 : 69, 921, 739
Stardust / PI 470121 alleles : A/G
Primer orientation : R
PCR primers
Allele-specific primer 1 5' acgatcctgcagcacgcT
Allele-specific primer 2 5' acgatcctgcagcacgcC
Common primer 5' gcggtacatgatcgacgacg