Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: Xstars-KASP335

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	Xstars-KASP335
Reference	Xu X et al. (2022) Identification and characterization of the novel leaf rust resistance gene Lr81 in wheat Theoretical and Applied Genetics 135:2725-2734.
General Remarks	SNP position in Chinese Spring IWGSC v1.0 : 69, 921, 739 Stardust / PI 470121 alleles : A/G Primer orientation : R
PCR primers	Allele-specific primer 1 5' acgatcctgcagcacgcT Allele-specific primer 2 5' acgatcctgcagcacgcC Common primer 5' gcggtacatgatcgacgacg