Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: KASP_PH2L

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	KASP_PH2L
Locus	BS00022245_51
Reference	Liu G et al. (2023) Identification of KASP markers and putative genes for pre-harvest sprouting resistance in common wheat (Triticum aestivum L.) 11:549-557.
General Remarks	SNP = C/T
PCR primers	SNP primer allele 1 5' AGCCCGGAATCCTTCGCA SNP primer allele 2 5' AGCCCGGAATCCTTCGCG Common primer 5' CGTCAACCTTCTTCACCCTG