Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: Stars-KASP656

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	Stars-KASP656
Reference	Xu X et al. (2023) Identification of a Novel Pm65 Allele Conferring a Wide Spectrum of Resistance to Powdery Mildew in Wheat Accession PI 351817 Phytopathology 113:1979-1984.
General Remarks	Position on Chinese Spring IWGSC RefSeq v2.1 2AL : 771, 207, 512 Product size = 70
Type	KASP
PCR primers	Allele-specific primer 1 ctgcacgcagctctacaaaA Allele-specific primer 2 ctgcacgcagctctacaaaT Reverse primer gctgggatttgggagagtgt