Query (optional)   in Class  

GrainGenes Probe Report: PLATZ-A1_splice

[What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
PLATZ-A1_splice
Reference
ReferenceZhang J et al. (2023) Wheat plant height locus RHT25 encodes a PLATZ transcription factor that interacts with DELLA (RHT1) Proceedings of the National Academy of Sciences, USA 120.
ReferenceDubcovsky J MAS Wheat. Bringing Genomics to the Wheat Fields. Plant height gene Rht25. MAS Wheat. Marker Assisted Selection in Wheat.
General Remarks
splice site mutations detected in the cultivar Patwin-515HP
See the MASWheat webpage for amplification conditions and note that those conditions should be considered only as a starting point of the method optimization at individual laboratories.
Type
KASP
PCR primers
Plz-splice-wt-FAM 5'- GAAGGTGACCAAGTTCATGCTactgtatatgcatgtgtgtctcA -3'
Plz-splice-mut-VIC 5'- GAAGGTCGGAGTCAACGGATTactgtatatgcatgtgtgtctcG -3'
Plz-splice-common 5'- CTTGAATGGCCTGGACTGAG -3'