Query (optional)   in Class  

GrainGenes Probe Report: PLATZ-A1_Promoter

[What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
PLATZ-A1_Promoter
Reference
ReferenceZhang J et al. (2023) Wheat plant height locus RHT25 encodes a PLATZ transcription factor that interacts with DELLA (RHT1) Proceedings of the National Academy of Sciences, USA 120.
ReferenceDubcovsky J MAS Wheat. Bringing Genomics to the Wheat Fields. Plant height gene Rht25. MAS Wheat. Marker Assisted Selection in Wheat.
General Remarks
'384-bp insertion in the promoter region 130 bp upstream of the start codon in CDC Landmark (CS RefSeq v1.1, 6A:145, 654, 767 - 145, 654, 768). '
See the MASWheat webpage for amplification conditions and note that those conditions should be considered only as a starting point of the method optimization at individual laboratories.
Type
KASP
PCR primers
plz-pro-ins-FAM 5'- GAAGGTGACCAAGTTCATGCTccatgcacgcgaaagatcaa -3'
plz-pro-wt-VIC 5'- GAAGGTCGGAGTCAACGGATTgaaaacaaaagagagatcaaacc -3'
plz-pro-common 5'- GCAATTCTCCTCTTGGTTGGT -3'