Query (optional)   in Class  

GrainGenes Reference Report: AUM-59-285

Reference
AUM-59-285
Title
Using biochemical and molecular markers for localization of Sec genes on chromosomes of rye ( Secale cereale L.) cv. Dankowskie Zlote
Journal
Annales Universitatis Mariae Curie-Skodowska.Sectio E, Agricultura
Year
2004
Volume
59
Pages
285-292
Author
Chrzastek M
Abstract
The series of lines of hexaploid wheat ( Triticum aestivum ) cv. Grana with added pairs of complete or telocentric chromosomes of rye ( Secale cereale ) cv. Dankowskie Zote (1R, 2R, 3R, 3RS, 4R, 5R, 6R, 6RL, 7R) and a 1B/1R substitution line were used for the identification of glutenin and secalin subunits and localization of Sec genes on rye chromosomes. The separation of high molecular glutenin and secalin subunits was determined using electrophoresis technique on polyacrylamide gel in the presence of sodium dodecyl sulfate (SDS-PAGE). In all tested lines and wheat, the Glu A1 locus determined block N (Null), therefore the lack of high-molecular weight subunits of glutenin. Glu B1 locus encoded subunits 6+8, and Glu D1 locus subunits 2 + 12. The presence of bands characteristic of rye storage proteins (secalins) was found in addition lines 1R and 2R as well as in substitution line 1B/1R. Chain reaction of polymerase (STS-PCR) was applied to identify Sec genes. The two specific primers: SECA2 (5prime - GTTTGCTGGGAATTATTTG - 3prime) and SECA3 (5prime - TCCTCATCTTTGTATTTG - 3prime) were used for localization of Sec 1 gene. Sec 2 gene was determined using R1 (5prime - CCCAGCAACAACAACCGTCGATTC - 3prime) and R2 (5prime - GTGGCCACATACCAGTGAC - 3prime) primers. Analysis of storage protein subunits and PCR products revealed that genes responsible for secalin biosynthesis in rye cv. Danprimekowskie Zote were located in the short arms of 1R and 2R chromosomes
Keyword
addition line
[ Show all 20 ]

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.