Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: CD373483

[Submit comment/correction]

Sequence	CD373483
Contig	NSFT03P2_Contig16424
External Databases	Data at GenBank Data at EMBL Data at DDBJ
wEST map position	CD373483
NCBI UniGene	Ta.54019
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Glyoxysomal malate dehydrogenase'
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	2BS 3DL 6BL
Clone Library	CS wheat cold-stressed seedling cDNA library
Tissue	Seedling
Developmental Stage	Five-day old seedling
Data Source	genbank Release 136, Jun 15 2003 genbank Updated Nov 2006
Title	WHE0359_D06_G11ZT CS wheat cold-stressed seedling cDNA library Triticum aestivum cDNA clone WHE0359_D06_G11, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE0359_D06_G11
Probe	WHE0359_D06_G11
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: T7 primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized , germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Five-day old seedlings were transferred to 5 C cold room and kept for 48 hr. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Five-day old seedlings were transferred to 5 C cold room and kept for 48 hr. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	tttttttttttttttttttttttttttttttttttttaatcagagagact cctcagccatcaggattcatttcagtacgttgaattacgtacacgctagt attacgacagtagtatatcttacggtacaaaaaggtaattcggagacatt attacttgaccaaatcacgcatcgagcaattcattcgagcacaaacaaat cggagtatctcgctcagctccttcttcgccttctccaggccggctctctc gaagtcattcagtggcccaagagggagaatctcctcggctccaccgcgac ctaacctcactttcgatgcgaagaacggcagctctgtcacctcagatgcg acatatgaacactccacgatgccagcatcaccacgcattcctcgcaggca cgcgtcggcgaattttgcagcagcaaaagccattgacaaagttgcagagc ctgctccagcctttgcctccacaacttctgtaccaccgttctgtatgcga ttagtcaaatagctgatttcatctggagtgaatgagcatggagggctgac ctgtgacaggaggggtaatatagtgacccctgcatgcccgccaacaactg gaacattgacttctcttggatcaactccaagcacttccgcc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.