Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: NSFT03P2_Contig16455

Sequence	CD453528
Contig	Ta.9622.1.S1_x_at Ta.9622.2.S1_a_at Ta.9622.3.S1_a_at NSFT03P2_Contig16455
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC315467
wEST map position	CD453528
NCBI UniGene	Ta.29004
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'DEAD-box ATPase-RNA-helicase'
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	3AS 3DS
Clone Library	CS wheat vernalized crown cDNA library
Tissue	Crown tissue of seedling
Developmental Stage	Five-week old seedling
Data Source	genbank Release 136, Jun 15 2003 genbank Updated Nov 2006
Title	WHE0802_D08_G16ZT CS wheat vernalized crown cDNA library Triticum aestivum cDNA clone WHE0802_D08_G16, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE0802_D08_G16
Probe	WHE0802_D08_G16
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: T7 primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were germinated and grown at 4 C for 5 weeks. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	tttttttttttttttttagttcagcagttcacgtcgggcatttcagttca acatcaagccatgccgagagcatttacaacagccaacataacttacatgg ttccgtccaaaattcatggctcaaccggtccggtttcctaaggattataa cacgactaccaggcataaagaggtccgaggttccaggtttcatagagtac taacgccagcatacggacaccgtataaagcgcctccgaggcaccaccaca tcaacatagcaaaatatccgacacgcttaacctatgtcagcaaagttcca ggacacgctttgcttaaaccaacatgactgatactacgatttggttaggg aaccaactccatctactccgttgtttcatcaccatcgtgatgcattttac cagttggagacccccacggccttgggagggctcctgctcctagcacggtc accaccacgggaattgccgctatagaacctatcatggaagctgagacctt caccagagccgccactggcaggtaaacttgcagcgccactggtctggttg ttgctactgctggtatgga

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.