Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: CD454397

Sequence	CD454397
Contig	Ta.9352.1.S1_at Ta.9352.3.S1_a_at NSFT03P2_Contig18074
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC278443
wEST map position	CD454397
NCBI UniGene	Ta.9352
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, strongly similar to NP_001051234.1 Os03g0743900 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	5AL 5BL 5DL
Clone Library	CS wheat pre-anthesis spike cDNA library
Tissue	Spike before anthesis
Developmental Stage	Adult plant
Data Source	genbank Release 136, Jun 15 2003 genbank Updated Nov 2006
Title	WHE2308_E12_J24ZT CS wheat pre-anthesis spike cDNA library Triticum aestivum cDNA clone WHE2308_E12_J24, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE2308_E12_J24
Probe	WHE2308_E12_J24
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: T7 primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Whole spike with awns trimmed, white, green and yellow anther were collected and total RNA, and poly(A ) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Whole spike with awns trimmed, white, green and yellow anther were collected and total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	ttttttttttttttttttttttttttaccacaatattgtatatgtagtta tgtacagatctggcaagaggatacaaaacccatccttattggcaccacaa gcacatgatgggctccagggggcaacactgctagcagatactagtatgca gtacacaaaccacacagggagtgttgggggatcatgcccaaatgtcaagt ctgaccaccaatatacaatcatatatcattggttcatgatacgagataca acgccacggcttctaagccgcaaccgcctctcgcggtttgctgctgcctt ctggtggtgccaagctgtcgtagtactcgacgaggaccttccagccaccc gggcacataaaaccatctggtgggctctcacggttcttggcaaggctacg catctttgtgccagagatgaacaggaagtcctctttcctcgatgggtcga agaaattcatcttgttatgctttgtgtcatatgcagccaccttgaaagga aggatattgagcctctcaagcccaggagccatgctcagtacttttttccc gtgatcagcatcataaaggtccctcttttcggttgggtggcccataccag cagggtctcttccgacaatatagaagtttgcaccagcatttat

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.