Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: CD454950

[Submit comment/correction]

Sequence	CD454950
Contig	Ta.7576.3.S1_a_at NSFT03P2_Contig16622
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC284179
wEST map position	CD454950
NCBI UniGene	Ta.53944
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, strongly similar to NP_001052905.1 Os04g0445800 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Clone Library	CS wheat salt-stressed sheath cDNA library
Tissue	Sheath
Developmental Stage	Adult plant
Data Source	genbank Release 136, Jun 15 2003 genbank Updated Nov 2006
Title	WHE2054_G03_N06ZT CS wheat salt-stressed sheath cDNA library Triticum aestivum cDNA clone WHE2054_G03_N06, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE2054_G03_N06
Probe	WHE2054_G03_N06
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: T7 primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown under hydroponic conditions at UC Davis, salt stressed for 12 hours, and for 7 days, then dissected and frozen (Akhunov in J Dvorak Lab). Total RNA was prepared from sheath tissue, equal quantities of RNA were pooled from the two samples, polyA was purified from the pooled RNA, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab at the University of California, Riverside (Akhunov, Chin, Choi, Close, Fenton, Kianian, Otto, Simons, Zhang). Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	tttttttttttttttttttaaataagaataagggccggtacattgctact gaggaagagcccctcggtccagagcattagggctgaacaacaagtataag acacagtgcaatcaggagcttccattgcccacaaacatagcaaatgccgc cattaaaaaccagcggccacaaagggagcaccaactatcaatcaacatga ctgactaatggatggacgctaatcgaagtctaggaactccatcctcttcc tcattgtgcctttcagatcccttgcttccttttcggctttctcggccgtt cttatttcagcctctgaaacacaagtcatgtgactagggagttcgtcctt ctcacgatccagttctccaattaatacaacattctctccccggatcacat ataaaccaagaggaacatcacaatataattcgcccacaattactcgttca caagcaccctgaagaacaacatttgcaaactgatcgaatgagcagagggt gccaagcagctttcgtccatctcgtagtaggacaattagttttttatcca anaagccggccagggaggtggagaggaggatctcgtcgggcccggcccaa gacatcgcgccgaacccaaatccggcgctagaaatagcagtagatggccc tgatcggccgcttcttcgattggagctctgtggttcgccgtcaggggat

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.