Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: CK085360

[Submit comment/correction]

Sequence	CK085360
External Databases	Data at GenBank Data at EMBL Data at DDBJ
DB Remark	Locus Source: Hordeum vulgare subsp. vulgare
Keyword	EST
Species	Hordeum vulgare subsp. vulgare
Cultivar	barke
Clone Library	BP
Tissue	pooled tissue
Data Source	genbank Release 141, Apr 15 2004 genbank Updated Nov 2006
Title	BP01M21w BP Hordeum vulgare subsp. vulgare cDNA clone BP01M21 3-PRIME, mRNA sequence.
Strain	lab_host DH10B vulgare
Clone	BP01M21
Probe	GBR1649
Remark	DB_xref: taxon:112509 Feature: source: mol_type = 'mRNA'; note = 'Vector: pBluescript SK+; Site_1: EcoRI (5-end of cDNA); Site_2: SmaI (3-end of cDNA); The RNA samples were pooled and subtracted against roughly 20,000 cDNA clones representing a unigene set based on sequencing results from the 22 IPK H* libraries. The insert can be relesed by EcoRI/SmaI or EcoRI/NotI. The library was custom made by the company GATC, Konstanz, Germany. Pooled tissue: culm basis incl. root initials, generative apex 5 mm, generative apex 1 cm, adventitious shoot buds < 5 mm, leaf midribs afternoon high light 16:00, leaf midribs; darkness 23:30, germinating seed 12 h after imbibition, germinating seed 62 h after imbibition, embryo 8 - 12 dpa, embryo 14 - 18 dpa, embryo 20 - 26 dpa, gynoeceum, anthers, second leaf of iron starved plants (15 days old seedlings), root tips of iron starved plants (15 days old seedlings).' Feature: source: mol_type = 'mRNA'; /note = 'Vector: pBluescript SK+; Site_1: EcoRI (5-end of cDNA); Site_2: SmaI (3-end of cDNA); The RNA samples were pooled and subtracted against roughly 20,000 cDNA clones representing a unigene set based on sequencing results from the 22 IPK H* libraries. The insert can be relesed by EcoRI/SmaI or EcoRI/NotI. The library was custom made by the company GATC, Konstanz, Germany. Pooled tissue: culm basis incl. root initials, generative apex 5 mm, generative apex 1 cm, adventitious shoot buds < 5 mm, leaf midribs afternoon/ high light/ 16:00, leaf midribs; / darkness/ 23:30, germinating seed 12 h after imbibition, germinating seed 62 h after imbibition, embryo 8 - 12 dpa, embryo 14 - 18 dpa, embryo 20 - 26 dpa, gynoeceum, anthers, second leaf of iron starved plants (15 days old seedlings), root tips of iron starved plants (15 days old seedlings).' Locus Comment: Contact: Stein Nils; Molecular Markers Group, Department Genbank; Institute of Plant Genetics and Crop Plant Research (IPK); Corrensstr. 3, 06466, Gatersleben, Germany; Tel: 039482-5522; Fax: 039482-5595; Email: stein@ipk-gatersleben.de; Insert Length: 700 Std Error: 0.00; Plate: 1 row: M column: 21; Seq primer: T7.
DNA	aaagagatgattgagaactttttggtccttggctacagtagcggatgcag aattttttattggtgtggcagaggttactagtatacatagcttggctcaa atcttcaattaagtactgcataaacctagtatacatggcatatgttaggt gtggcagtagccaaaccttgccagattgctggcttcgccactgcttggct atatgagtggttcggggtaccattgcactgagtgnnagtgctggtagagt ggtanatataatatgctaatactttttgaaatgacttattttccttggtt cttactcactttcatgtacttgcacatgttaccatcaatgtgcaatacaa ttgccacaccaactaacatcacatgnattactcgatagtgattttcttgt ggaaacatctatatataaataccttattccttactgntttctcatccatt ttctcatggttataatgtagatgttgaattctgatggaaacgccaacaaa gtagatgngtgaaaagctcaccatatgagctctttggcaatgaaaaagct ttccatatttgtgccggngtggttccaaatctggcttttttctttatatt gaaatgagcatganaggtgttgggaggttttatatccccgaataaggata ttttccangggctggagctgttgggtcaaactataanaacgttggttcaa

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.