Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: AY311483

Sequence	AY311483
Subsequence	AY311483_1.cds 1 438
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC4450
Data at Gramene	Gramene-Protein Q7XJJ0
DB Remark	Locus Source: Secale cereale (rye)
Species	Secale cereale
Data Source	genbank Release 137, Aug 15 2003 genbank Downloaded 2008-2009
Title	Secale cereale dehydration responsive element binding protein mRNA, partial cds.
Remark	DB_xref: taxon:4550 Feature: source: mol_type = 'mRNA';
DNA	tgcctcaacttcgccgactccgcctggcggatgctgcccgtgctcgnggg cggctccttcggctttgatagcacgcgggaggtcaaggccgccgtcgccg tcgccgtcgtcgcgttccagcggaagcagattattccagtcgccgtcgcc gtcgtggcgctccagcagcagcaggttccagtcggcgtggccgtcgtggc gctccagcagaagcaggttccagtcgccgtggccgtcgtggcgctccagc agaagcaggttccggtcgccgtcgccgtcgtggcgctccagaagcagcag attattcttccagccgcatgcctggcgccggagttctacatgtcttccgg cgacctcttggagctcgacgaggagcagtggtttgggcggcatggacgcc ggggtcgtactacgccagcttggcgcaggggatgctcg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.