Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: EU146233

Sequence	EU146233
Subsequence	EU146233_1.cds 1 493
External Databases	Data at GenBank Data at EMBL Data at DDBJ
DB Remark	Locus Source: Secale cereale (rye)
Species	Secale cereale
Chromosome	7R
Data Source	genbank Downloaded 2008-2009
Title	Secale cereale ALMT1-M39.5 gene, partial cds.
Gene Product	ALMT1-M39.5
Remark	DB_xref: taxon:4550 Feature: source: mol_type = 'genomic DNA'; map = '7RS; Alt4 locus'; Note: genotype: M39A-1-6
DNA	caccgtcgtcgtcgtcatggagttcactgtcggtacgcgcgggcgctcgt atatgatcagtcacattcataccacataccataaccataccagcatatta tgcatgcgcgcagtgtcttctagtctgaaacgcacttgcattgtgttctc cgatgccgaaacgtgacaggtgccacgctgagtaaaggcttgaaccgagc tatggcgacattagtggctggctgcatcgccgttggagctcaccaattag ctgaactagctgaacgctgtagtgaccagggagagcccgtaatgctcacc gtgctcgtcttcttcgtgggtacgtagtacacatccgcatggttaattag tactactgtactaccctttggtttcgagactctctctttttagttactac tccttgcataatggtggactggtgttcaacgcagcgtcagcggcgacgtt cttgcgcttcatcccggagatcaaagccaagtacgactacggcgt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.