Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: FJ374599

Sequence	FJ374599
Subsequence	FJ374599_1.cds 1 604
External Databases	Data at GenBank Data at EMBL Data at DDBJ
DB Remark	Locus Source: Secale cereale (rye)
Species	Secale cereale
Cultivar	USDA_PI561793
Chromosome	3B
Data Source	genbank Downloaded 2008-2009
Title	Secale cereale putative bifunctional polymyxin resistance arnA protein gene, exons 1 through 3 and partial cds.
Gene Product	putative bifunctional polymyxin resistance arnA protein
Remark	DB_xref: taxon:4550 Feature: source: mol_type = 'genomic DNA'; Note: genotype: D06-3
EMBL Feature	exon 1 144 1 Location: <1..144 exon 345 437 2 Location: 345..437 exon 548 604 3 Location: 548..>604
DNA	gtcctcgccgtcgacgtctactgcgacaagatccgccacctcgtcgaccc gcccccgccccacctcgccgggcgcatctccttccaccgcctcaacatca agaacgactcccgcctcgagggcctcatcaagatggccgatctggtacgc ccttccccttcccctccacccctccctctaacggcgggcggattggcctg cgaaaaacgccgattttcccgggatttggtttcttgattcggttgccgat ggcgcgttcgtcgcctgaaaaatagttcgcgtcccctgaaattttcttgt tggaaaaccgctgacgattttgttgttggatctgctccgcgaagacgata aacctggcggcgatctgcacgccggcggactacaacacgcggccgctcga caccatctacagcaacttcatcgacgcgctcccggtggtacgtgctcnnn nnnnnnnnnnnnnnnnnntatattctctcggcgctttcggcgtcgccaag caaagaatgtatgtatgcctgatcgtcacstgtctgtckgtgcgcaggtc aagtactgctcggagaacagcaagcgcctgatccacttctccacgtgcga ggtc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.