Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: FJ866904

Sequence	FJ866904
Subsequence	FJ866904_1.cds 1 462
External Databases	Data at GenBank Data at EMBL Data at DDBJ
DB Remark	Locus Source: Brachypodium distachyon
Species	Brachypodium distachyon
Data Source	genbank Downloaded 2008-2009
Title	Brachypodium distachyon isolate Bd12 EXP6 gene, partial cds.
Strain	Bd12
Gene	EXP6
Gene Product	EXP6
Remark	DB_xref: taxon:15368 Feature: source: mol_type = 'genomic DNA';
EMBL Feature	feature_gene 1 462 Location: <1..>462
DNA	cagtccgcccacgccaccttctacggcggcagcgacgcctccggcaccat gggtaactaactaacctcgtctcgtaagttctcaaccatggcggactccg gttttgactaatcttggcacttgggcactttggcagggggggcgtgcggg tacgggaacctgtacagccagggctacggggtgaacaacgcggcgctgag cacggcgctcttcaacggcgggcagcgctgcggggcctgcttcgagatca agtgcgtgaaccagcccgactggaagtggtgccacccgggctcgccgtcc atcctcgtcacggccaccaacttctgcccgcccaactacgcgctgccttc cgacgatggcggctggtgcaacccgccccggccccacttcgacctcgcca tgcccatgttcctccacatcgccgagtaccgcgccggcatcgtccccgtc acttaccgccgg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.