Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: M15207

Sequence	M15207
Subsequence	M15207_1.cds 67 420
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC171333
NCBI UniGene	Hv.23091
Data at Gramene	Gramene-Protein P07597
DB Remark	Locus Source: Hordeum vulgare UniGene title 'Amylase/protease inhibitor'
Keyword	amylase/protease inhibitor
Species	Hordeum vulgare
Data Source	genbank Release 135, Apr 15 2003
Title	Barley (H.vulgare) probable amylase/protease inhibitor (PAPI) gene, complete cds.
Gene Product	PAPI mRNA amylase/protease inhibitor mature peptide
Remark	DB_xref: taxon:4513 Feature: source: mol_type = 'mRNA'; Locus Comment: Original source text: Barley (H.vulgare L.; cv.Himalaya) aleurone; tissue, cDNA to mRNA, clone A1f.; Draft entry and computer-readable sequence of [1] kindly provided; by J.C.Rogers (23-MAR-1987).; This sequence lacks the 'aataaa' polyadenylatin signal usually; found preceding the poly-A tail, although it does contain the; sequence 'aataag' at position 528, 122 bp upstream of the polyA; tail.
EMBL Feature	mat_peptide 142 417 Location: 142..417 sig_peptide 67 141 amylase/protease inhibitor signal peptide Location: 67..141
DNA	gacctccacgagttgctcatcactagctagtacgttgtactgttagctac agattaagaagtgatcatggcccgcgctcaggtactgctcatggccgccg ccttggtgctgatgctcacggcggccccgcgcgctgccgtggccctcaac tgcggccaggttgacagcaagatgaaaccttgcctgacctacgttcaggg cggccccggcccgtccggcgaatgctgcaacggcgtcagggatctccata accaggcgcaatcctcgggcgaccgccaaaccgtttgcaactgcctgaag gggatcgctcgcggcatccacaatctcaacctcaacaacgccgccagcat cccctccaagtgcaatgtcaacgtcccatacaccatcagccccgacatcg actgctccaggatttactgagcgacgatccgtcaagctggtgctcagctc atcgatccacgtggagctgaagcgcgcagcctctgtccctatgtagtatg gctaccagttatgccgagtttatgctgaataagaactctctcctgtactc ctttggaggagatcagtatctatgtacgtagagttgagagtttgtaccat gggcactcccagtgttcatggactatatgcatacacctccttctgtgctc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.