Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: TaAffx.79549.1.S1_s_at

Sequence	TaAffx.79549.1.S1_s_at
Contigset	Affymetrix Wheat1 GeneChip
Contig Members	BQ166742 [ Show all 43 ]
Data at PLEXdb	Probe annotation
Data Source	Affymetrix 2006.02
DNA Homology	BF202975
DNA	ccgaaaccgcgtcggctcacggagtccaccaccagtctcctcccctcctc cttctcctcctacccccgcctccaaggcccctccgcccgcccgccgacct ggtccgctggtccggggtgctctgtccggcacgaatccatcggcgcttgt tgcgggaatgcgggggagttcattggngagccgctatgggttgcttcccg tgcttcgattcgggctcngacggggagctgctctaccccaagcagggcgg nggnggcggcggaaatggcatgggcgganggactgcggccgcggtatcnt nctccggngtcggtgccccgcgagggngacaancatggtcccggccgcnc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.