Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: X02014

[Submit comment/correction]

Sequence	X02014
External Databases	Data at GenBank Data at EMBL Data at DDBJ
DB Remark	Locus Source: Secale cereale (rye)
Keyword	5S ribosomal RNA ribosomal RNA
Species	Secale cereale
Data Source	genbank Release 136, Jun 15 2003 genbank Release 135, Apr 15 2003 genbank Downloaded 2008-2009
Title	Rye 5S ribosomal RNA.
Strain	c.v. Lovaszpatonai
Gene Product	5S ribosomal RNA
Remark	DB_xref: taxon:4550 Feature: source: mol_type = 'genomic DNA'; Feature: source: mol_type = 'mRNA';
EMBL Feature	rRNA 1 118
DNA	ggatgcgataccatcagcactaaagcaccggatccatcagaactccgaag ttaagcgtgcttgggcgagagtagtactaggatgggtgacctcctgggaa gtcctcgtgttgcatcct

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.