Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: X15257

Sequence	X15257
Subsequence	X15257_1.cds 58 366
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC173849
NCBI UniGene	Hv.512
Data at Gramene	Gramene-Protein P20145
DB Remark	Locus Source: Hordeum vulgare UniGene title 'Aleurone specific protein'
Keyword	aleurone specific protein
Species	Hordeum vulgare
Data Source	genbank Release 145, Dec 15 2004 genbank Release 135, Apr 15 2003
Title	Barley mRNA for aleurone specific protein.
Gene Product	aleurone specific protein
Remark	DB_xref: taxon:4513 Feature: source: mol_type = 'mRNA'; Feature: source: mol_type = 'mRNA'
EMBL Feature	mat_peptide 142 363 alternate Location: 142..363 [ Show all 8 ]
DNA	cgagagcgagcgtgtgagtgtagccgagtagatcaccgtacgacgacgac gaggggcatggcgatggcgatggggatggcgatgaggaaggaggcagcgg tggccgtgatgatggtgatggtggtgacgctggcggcgggtgcggacgcg ggagcgggagcggcgtgcgagccggcgcagctggcggtgtgcgcgtcggc gatcctgggcgggacgaagccgagcggcgagtgctgcgggaacctgcggg cgcagcaggggtgcttgtgccagtacgtcaaggaccccaactacgggcac tacgtgagcagcccacacgcgcgcgacaccctcaacttgtgcggcatacc cgtaccgcactgctagccgcctagccgatcgagggctccaggcacgcatg catgttcctgttatgtggatgttggaataaaatgctggtgatctatggcg gctagcttgcttcctggctagcagctgctgtaatg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.