Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: X15692

Sequence	X15692
Subsequence	X15692_1.cds 31 549
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC159585
NCBI UniGene	Hv.163
Data at Gramene	Gramene-Protein P14897
DB Remark	Locus Source: Hordeum vulgare subsp. vulgare UniGene title 'Chloroplast low molecular mass early light-inducible protein (ELIP) (clone HV90)'
Keyword	early light-inducible protein light-inducible protein thylakoid membrane protein thylakoid protein
Species	Hordeum vulgare subsp. vulgare
Tissue	leaf
Data Source	genbank Release 135, Apr 15 2003
Title	Barley mRNA for chloroplast low molecular mass early light-inducible protein (ELIP) (clone HV90).
Strain	Aramir
Clone	HV90
Gene Product	mature low molecular mass early light-inducible protein (AA 1-134)
Remark	DB_xref: taxon:112509 Feature: source: mol_type = 'mRNA'; Locus Comment: See also <X15691> and <X15693> for clones HV60 and HV58.
EMBL Feature	mat_peptide 145 546 Location: 145..546 misc_feature 629 633 pot. polyA signal Location: 629..633 sig_peptide 31 144 signal peptide (AA -38 to -1) Location: 31..144
DNA	tacgtgcaccttccatccacatgctgatcaatggcgaccatgatgtccat gagctccttcgccggtgcggccgtcgtgccgcgcagctcggccagcagct tcggcgcccggtctctgccagcgctgggccgacgcgccctcgtcgtcagg gcacagaccgagggcccgagcgcaccaccgccaaacaaacccaaggcgag cacctcgatctgggacgagatggcgttcagcggccctgcgccggagcgca tcaacgggcggctagccatggtgggcttcgtgacggcgcttgcggtggag gcagggcgcggcgacgggctcctctcgcagctcggcagcggcaccgggca ggcgtggttcgcctacaccgtggcggtgctgtccatggcgtcgctggtgc cgctgctccagggcgagagcgccgagggcagagccggcgccatcatgaac gccaacgcggaactctggaacggccgcttcgccatgctcggactcgtcgc gctggccgccaccgagatcatcaccggcgcgcctttcatcaacgtgtaga ataaaatagctttgctgtcgacaggataacacaacatgtacttagctagt aggacatgtaaatggtcagattttttttagaaaaaaaggaggttcaattc cgacctctgc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.