Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: X57270

Sequence	X57270
Subsequence	X57270_1.cds 60 368
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC173849
NCBI UniGene	Hv.512
Data at Gramene	Gramene-Protein P20145
DB Remark	Locus Source: Hordeum vulgare subsp. vulgare UniGene title 'Aleurone specific protein'
Keyword	LTp gene phospholipid transfer protein transfer protein
Species	Hordeum vulgare subsp. vulgare
Cultivar	Bomi
Clone Library	lambda-ZAP
Tissue	seed
Data Source	genbank Release 145, Dec 15 2004 genbank Release 135, Apr 15 2003
Title	H.vulgare mRNA for putative phospholipid transfer protein.
Strain	vulgare
Clone	B14A
Remark	DB_xref: taxon:112509 Feature: source: mol_type = 'mRNA'; haplotype = 'triploid'; cell_type = 'aleurone'; Feature: source: mol_type = 'mRNA'; haplotype = 'triploid'; cell_type = 'aleurone' Gene: Ltp
EMBL Feature	polyA_signal 428 433 putative Location: 428..433 polyA_signal 484 489 putative Location: 484..489 feature_gene 1 517 Location: 1..517
DNA	tgcgagagcgagcgtgtgagtgtagccgagtagatcaccgtacgacgacg acgaggggcatggcgatggcgatggggatggcgatgaggaaggaggcagc ggtggccgtgatgatggtgatggtggtgacgctggcggcgggtgcggacg cgggagcgggagcggcgtgcgagccggcgcagctggcggtgtgcgcgtcg gcgatcctgggcgggacgaagccgagcggcgagtgctgcgggaacctgcg ggcgcagcaggggtgcttgtgccagtacgtcaaggaccccaactacgggc actacgtgagcagcccacacgcgcgcgacaccctcaacttgtgcggcata cccgtaccgcactgctagccgcctagccgatcgagggctccaggcacgca tgcatgttcctgttatgtggatgttggaataaaatgctggtgatctatgg cggctagcttgcttcctggctagcagctgctgtaatgaaatttgtgttgc aactttttttttagtcc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.