Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: X62453

[Submit comment/correction]

Sequence	X62453
External Databases	Data at GenBank Data at EMBL Data at DDBJ
DB Remark	Locus Source: chloroplast Hordeum vulgare subsp. vulgare
Keyword	transfer RNA transfer RNA-Asp
Species	Hordeum vulgare subsp. vulgare
Cultivar	Svaloef's Bonus
Data Source	genbank Release 136, Jun 15 2003 genbank Release 144, Oct 15 2004 genbank Release 135, Apr 15 2003
Title	H. vulgare plastid tRNA-Asp.
Strain	Svaloefs Bonus vulgare
Gene Product	tRNA-Asp
Remark	DB_xref: taxon:112509 [ Show all 15 ]
EMBL Feature	misc_feature 38 38 modified adenosine Location: 38 [ Show all 7 ]
DNA	gggattgtagttcaattggtcagagcaccgccctgtcaaggcggaagctg cgggttcgagccccgtcagtcccgcca

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.