Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c34604_222

[Submit comment/correction]

Sequence	BobWhite_c34604_222
Contig	1DS_1666915
Probe	BobWhite_c34604_222
DNA Homology	1DS_1666915 Best IWGSC match 121 2e-25 URGI_Best IWGSC_N
BLAST, e-value	2e-25 1DS_1666915 Best IWGSC match
DNA	aagtcgagaccccatccatgaaccaaatcattctgaatcatatgccatac Rcatcgccatgcctcccttgagaagactggagccattatttcaacaaacg c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.