Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 1DS_1913945

[Submit comment/correction]

Sequence	Excalibur_c45969_370
Contig	1DS_1913945 1DS_1895912
Species	Triticum aestivum
Probe	Excalibur_c45969_370
DNA Homology	1DS_1913945 Best IWGSC match 156 7e-36 URGI_Best IWGSC_N
BLAST, e-value	7e-36 1DS_1913945 Best IWGSC match
DNA	ctttctttatccacccttgcagtgcggagagttggctgggcatgtatgac Rcaaattcgcggagatgtacaggaggcacccagcgttctcccaagagatc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.