Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BS00003761_51

[Submit comment/correction]

Sequence	BS00003761_51
Contig	1AS_3231176
Probe	BS00003761_51
DNA Homology	1AS_3231176 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 1AS_3231176 Best IWGSC match
DNA	aggcattgcaaccggcgccctggtctctgctgctaccaacaacaaaggga Rcaagatcgcccaggacgccatcaccggaggcgccatcgcgaccgccgtc g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.