Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IACX1465

[Submit comment/correction]

Sequence	IACX1465
Contig	1AS_3306225
Probe	IACX1465
DNA Homology	1AS_3306225 Best IWGSC match 163 4e-38 URGI_Best IWGSC_N
BLAST, e-value	4e-38 1AS_3306225 Best IWGSC match
DNA	atgttgggaacgtcgtagttctgggcgatgtagatgccgcccgcggcgcc gaccagcagcRagaaggtgctctggatgaagcccattgggagcaagtaa

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.