Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c11374_1126

[Submit comment/correction]

Sequence	Excalibur_c11374_1126
Contig	1DS_1908149
Probe	Excalibur_c11374_1126
DNA Homology	1DS_1908149 Best IWGSC match 121 2e-25 URGI_Best IWGSC_N
BLAST, e-value	2e-25 1DS_1908149 Best IWGSC match
DNA	tagttttcttgacttccttttttgatggctcagtcttggcatcagtatcc Rtaggagcagatttttcctcagaatcttgtgccccatctccagtagcacc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.