Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-0431_601

[Submit comment/correction]

Sequence	GENE-0431_601
Contig	1BS_3433062
Probe	GENE-0431_601
DNA Homology	1BS_3433062 Best IWGSC match 172 5.99994e-41 URGI_Best IWGSC_N
BLAST, e-value	5.99994e-41 1BS_3433062 Best IWGSC match
DNA	gggaactcaaagagggcatgctgcaatacttgaaatgtagacatcatacc Rtagagaatcgggagcgggaatcaycagcagagcagcttagttgaac

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.