Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 1AS_3275296

[Submit comment/correction]

Sequence	wsnp_BF478737A_Ta_2_1
Contig	1AS_3275296
Probe	wsnp_BF478737A_Ta_2_1
DNA Homology	1AS_3275296 Best IWGSC match 152 7e-35 URGI_Best IWGSC_N
BLAST, e-value	7e-35 1AS_3275296 Best IWGSC match
DNA	TGTCTGATACTGTTAAACACTGTTGTGGATTGACGCACCCAACATGATGA TGATAGTAGTKGCATCATCCCAACATTCAGTATGGTTG

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.