Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c65515_283

[Submit comment/correction]

Sequence	RAC875_c65515_283
Contig	6BS_2990008
Probe	RAC875_c65515_283
DNA Homology	6BS_2990008 Best IWGSC match 176 4.99983e-42 URGI_Best IWGSC_N
BLAST, e-value	4.99983e-42 6BS_2990008 Best IWGSC match
DNA	tcttcatcagaagactccatctcagactcatcactagacaaatcagccaa Rtgaagtttctctgtcatagaaggctgcagtggtggagggggaggaggaa g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.