Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Kukri_c23350_433

[Submit comment/correction]

Sequence	Kukri_c23350_433
Contig	1DL_1156496
Probe	Kukri_c23350_433
DNA Homology	1DL_1156496 Best IWGSC match 148 1e-33 URGI_Best IWGSC_N
BLAST, e-value	1e-33 1DL_1156496 Best IWGSC match
DNA	tgatcaatgtcactagaaccctggagaaatggtcgtctaagcagcaactc Rgcaaaaatacaaccagcagcccaaacatcaacggcagatccatactgct t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.