Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c53185_802

[Submit comment/correction]

Sequence	RAC875_c53185_802
Contig	1DL_2290736
Probe	RAC875_c53185_802
DNA Homology	1DL_2290736 Best IWGSC match 172 7.00005e-41 URGI_Best IWGSC_N
BLAST, e-value	7.00005e-41 1DL_2290736 Best IWGSC match
DNA	ctcaggcaaaaagaaaactttagatgaacagtgccagagcaaactgcagc Rctgatgcacttgcgatcaaagccatcatatcagctccttcggtgcattc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.