Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RFL_Contig3919_551

[Submit comment/correction]

Sequence	RFL_Contig3919_551
Contig	1DL_933550
Probe	RFL_Contig3919_551
DNA Homology	1DL_933550 Best IWGSC match 73 7e-11 URGI_Best IWGSC_N
BLAST, e-value	7e-11 1DL_933550 Best IWGSC match
DNA	ccatccgcgaggacgaggtcaccgccatggtcgagtccgtccaccgcgcc Rccgccggccccggtaatgaaggaaagccattggtagtgaggaatcacct t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.