Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 1AL_3943350

[Submit comment/correction]

Sequence	RAC875_c23168_480
Contig	1AL_3943350
Probe	RAC875_c23168_480
DNA Homology	1AL_3943350 Best IWGSC match 180 3.9937e-43 URGI_Best IWGSC_N
BLAST, e-value	3.9937e-43 1AL_3943350 Best IWGSC match
DNA	ccgtgtatccctgcagcagcaaggcgcgccccacgctttgcaacgatgtc Rcatacggccacaactagccgtctcgttttaagtgaagtgccctggatcc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.