Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: CAP12_c3758_112

[Submit comment/correction]

Sequence	CAP12_c3758_112
Contig	1AL_3964664
Probe	CAP12_c3758_112
DNA Homology	1AL_3964664 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 1AL_3964664 Best IWGSC match
DNA	acagcgtcgcagctcttcgccgtgtcgctgttcccctacctggggttcct Mtacttcatgacccggtccaagacggcgcccgggctcacgctcttcggct t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.