Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c39092_629

[Submit comment/correction]

Sequence	BobWhite_c39092_629
Contig	1DL_2240965
Probe	BobWhite_c39092_629
DNA Homology	1DL_2240965 Best IWGSC match 139 5e-31 URGI_Best IWGSC_N
BLAST, e-value	5e-31 1DL_2240965 Best IWGSC match
DNA	acccctagaagtgacatcaccctagcRccctcggtaatgtggctgttgtc ttggtcagggatgccgtatgccgagat

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.