Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: TA001430-0733

[Submit comment/correction]

Sequence	TA001430-0733
Contig	1DL_2240800
Probe	TA001430-0733
DNA Homology	1DL_2240800 Best IWGSC match 97 2e-18 URGI_Best IWGSC_N
BLAST, e-value	2e-18 1DL_2240800 Best IWGSC match
DNA	aaacatctcataatattgaccatctttgcgacaatgccttccaaacagtt Mcaa

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.