Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BS00010868_51

[Submit comment/correction]

Sequence	BS00010868_51
Contig	3DL_6837169
Probe	BS00010868_51
DNA Homology	3DL_6837169 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 3DL_6837169 Best IWGSC match
DNA	tgtggtgaggtctctctgcaagctgcgcagcgtgttgccaagtcagttca Rtactccagcgagtgttcaaatgcccttatgaagaaaattggtcttggcg g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.