Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Kukri_c30661_321

[Submit comment/correction]

Sequence	Kukri_c30661_321
Contig	7DS_1228736
Probe	Kukri_c30661_321
DNA Homology	7DS_1228736 Best IWGSC match 141 2e-31 URGI_Best IWGSC_N
BLAST, e-value	2e-31 7DS_1228736 Best IWGSC match
DNA	gctgggcgcatccatggccacattgcgtccttgaccgacctcaacgctgc Rttgtcgaacggcctcgattggcagtgatgaacggactagggcggcggtt g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.