Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 4AL_7156808

[Submit comment/correction]

Sequence	BobWhite_c5441_151
Contig	4AL_7156808
Probe	BobWhite_c5441_151
DNA Homology	4AL_7156808 Best IWGSC match 128 1e-27 URGI_Best IWGSC_N
BLAST, e-value	1e-27 4AL_7156808 Best IWGSC match
DNA	tggtcaacttcactccatagatcttccatttcttcagaatttacacgatc Rgggtggaccattcctaactgacaaagtgcctggcagaagcttgaatatg t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.