Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IACX7053

[Submit comment/correction]

Sequence	IACX7053
Contig	1AS_3272302
Probe	IACX7053
DNA Homology	1AS_3272302 Best IWGSC match 178 1.99965e-42 URGI_Best IWGSC_N
BLAST, e-value	1.99965e-42 1AS_3272302 Best IWGSC match
DNA	tgcagggacttcttcagcttctccgcggcaaggaagaatggataggctag atggctctgcRcgccttatgatcgtttcggatcttgaccagacgatggtt gatcactgtgatccagagaa

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.