Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IACX6858

[Submit comment/correction]

Sequence	IACX6858
Contig	1BS_3461542
Probe	IACX6858
DNA Homology	1BS_3461542 Best IWGSC match 137 3e-30 URGI_Best IWGSC_N
BLAST, e-value	3e-30 1BS_3461542 Best IWGSC match
DNA	tccttctgaatcttttcttcggccagacccctgcctcctgcggcgcaaac cRaaacgacgatgagcagtagaagaacaactgaaactctaccaactctgc tggagcccatct

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.